alphalmager 3400 imaging software (Alpha Innotech)
86
Structured Review
Alpha Innotech
alphalmager 3400 imaging software
Alphalmager 3400 Imaging Software, supplied by Alpha Innotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alphalmager+3400+imaging+software/3400+alphalmager+imaging+software/hammami_akil__2017__role_du_hypoxia_inducible_factor_1a_hif_1a_durant_la_leishmaniose_viscerale-1292-8-12
Average 86 stars, based on 1 article reviews
Alphalmager 3400 Imaging Software, supplied by Alpha Innotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alphalmager+3400+imaging+software/3400+alphalmager+imaging+software/hammami_akil__2017__role_du_hypoxia_inducible_factor_1a_hif_1a_durant_la_leishmaniose_viscerale-1292-8-12
Average 86 stars, based on 1 article reviews
alphalmager 3400 imaging software - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: La cystéine protéase b régule la virulence de leishmania mexicana par la modulation de l'expression de GP63 Article Snippet: One-tenth of the resulting cDNA was amplified by PCR on a DNA thermal cycler, version 2.3 (Perkin-Elmer Corporation, Norwalk, CT), with the following primer pairs: for the L. mexicana gp63 C-l ACCGTCTGAGAGTCGGAACT (forward), GTAGTCCAGGAATGGCGAGT (reverse); and for o- tubulin CTATCTGCATCCACATTGGC (forward), ACTTGTCAGAGGGCATGGA (reverse). .. The PCR products were analyzed by electrophoresis on a 3% (wt/vol) agarose gel, and the pictures were taken using Electrophoresis:Article Title: La cystéine protéase b régule la virulence de leishmania mexicana par la modulation de l'expression de GP63 Article Snippet: One-tenth of the resulting cDNA was amplified by PCR on a DNA thermal cycler, version 2.3 (Perkin-Elmer Corporation, Norwalk, CT), with the following primer pairs: for the L. mexicana gp63 C-l ACCGTCTGAGAGTCGGAACT (forward), GTAGTCCAGGAATGGCGAGT (reverse); and for o- tubulin CTATCTGCATCCACATTGGC (forward), ACTTGTCAGAGGGCATGGA (reverse). .. The PCR products were analyzed by electrophoresis on a 3% (wt/vol) agarose gel, and the pictures were taken using Agarose Gel Electrophoresis:Article Title: La cystéine protéase b régule la virulence de leishmania mexicana par la modulation de l'expression de GP63 Article Snippet: One-tenth of the resulting cDNA was amplified by PCR on a DNA thermal cycler, version 2.3 (Perkin-Elmer Corporation, Norwalk, CT), with the following primer pairs: for the L. mexicana gp63 C-l ACCGTCTGAGAGTCGGAACT (forward), GTAGTCCAGGAATGGCGAGT (reverse); and for o- tubulin CTATCTGCATCCACATTGGC (forward), ACTTGTCAGAGGGCATGGA (reverse). .. The PCR products were analyzed by electrophoresis on a 3% (wt/vol) agarose gel, and the pictures were taken using Imaging:Article Title: La cystéine protéase b régule la virulence de leishmania mexicana par la modulation de l'expression de GP63 Article Snippet: One-tenth of the resulting cDNA was amplified by PCR on a DNA thermal cycler, version 2.3 (Perkin-Elmer Corporation, Norwalk, CT), with the following primer pairs: for the L. mexicana gp63 C-l ACCGTCTGAGAGTCGGAACT (forward), GTAGTCCAGGAATGGCGAGT (reverse); and for o- tubulin CTATCTGCATCCACATTGGC (forward), ACTTGTCAGAGGGCATGGA (reverse). .. The PCR products were analyzed by electrophoresis on a 3% (wt/vol) agarose gel, and the pictures were taken using Article Title: Rôle du hypoxia inducible factor 1α (HIF-1α) durant la leishmaniose viscérale Article Snippet: .. Densitometric analysis was performed by spot densitometry using Software:Article Title: La cystéine protéase b régule la virulence de leishmania mexicana par la modulation de l'expression de GP63 Article Snippet: One-tenth of the resulting cDNA was amplified by PCR on a DNA thermal cycler, version 2.3 (Perkin-Elmer Corporation, Norwalk, CT), with the following primer pairs: for the L. mexicana gp63 C-l ACCGTCTGAGAGTCGGAACT (forward), GTAGTCCAGGAATGGCGAGT (reverse); and for o- tubulin CTATCTGCATCCACATTGGC (forward), ACTTGTCAGAGGGCATGGA (reverse). .. The PCR products were analyzed by electrophoresis on a 3% (wt/vol) agarose gel, and the pictures were taken using Article Title: Rôle du hypoxia inducible factor 1α (HIF-1α) durant la leishmaniose viscérale Article Snippet: .. Densitometric analysis was performed by spot densitometry using Control:Article Title: Rôle du hypoxia inducible factor 1α (HIF-1α) durant la leishmaniose viscérale Article Snippet: .. Densitometric analysis was performed by spot densitometry using |